Putative DNA Quadruplex Formation within the Human c-kit Oncogene
Citations Over TimeTop 1% of 2005 papers
Abstract
The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.
Related Papers
- → Circular dichroism spectra demonstrate formation of the thrombin-binding DNA aptamer G-quadruplex under stabilizing-cation-deficient conditions(2006)155 cited
- → Label-free fluorescent and electrochemical biosensors based on defective G-quadruplexes(2018)19 cited
- → Going Platinum to the Tune of a Remarkable Guanine Quadruplex Binder: Solution‐ and Solid‐State Investigations.(2020)18 cited
- → Going Platinum to the Tune of a Remarkable Guanine Quadruplex Binder: Solution‐ and Solid‐State Investigations.(2020)1 cited
- → Investigating C-kit1 G-Quadruplex Stability using Nanopore(2020)