Facile Synthesis of Oligodeoxyribonucleotides via the Phosphoramidite Method without Nucleoside Base Protection

Citations Over TimeTop 18% of 1998 papers

Abstract

A facile synthesis of oligodeoxyribonucleotides via the phosphoramidite approach without base protection of the building blocks has been developed; it relies on the use of imidazolium triflate as a promoter for the condensation of a nucleoside phosphoramidite and a nucleoside. In the solution phase, the condensation is accomplished in a highly O-selective manner by using equimolar amounts of an N-free nucleoside phosphoramidite and an N-unblocked nucleoside to give, after oxidation with bis(trimethylsilyl)peroxide or with tert-butyl hydroperoxide, a dinucleoside phosphate in >95% yield. In the solid-phase synthesis, which requires an excess amount of the phosphoramidite for the condensation, deoxyadenosine and deoxycytidine undergo N-phosphitylation to some extent. The undesired product, however, can be converted to the N-free derivative by brief treatment with benzimidazolium triflate in methanol. Thus the overall process allows the chemoselective formation of internucleotide linkage. The oligomers prepared by this N-unprotected solid-phase approach include 5‘GTCACGACGTTGTAAAACGAC3‘ (21mer), 5‘CAGGAAACAG-CTATGACCATG3‘ (21mer), 5‘CAAGTTGATGAACAATACTTCATACCTAAACT3‘ (32mer), and 5‘TATGGGCCTTTTGATAGGATGCTCACCGAGCAAAACCAAGAACAA-CCAGGAGATTTTATT3‘ (60mer), which are provided in excellent quality. PCR amplification of DNAs using the crude 21mers as primers is also demonstrated.

Related Papers

• → Synthesis of pentathymidylate using a 4-monomethoxytritylthio (MMTrS) group as a 5′-hydroxyl protecting group: toward oligonucleotide synthesis without acid treatment(2001)13 cited
• → Utility of Azolium Triflates as Promoters for the Condensation of a Nucleoside Phosphoramidite and a Nucleoside in the Agrawal's Stereoselective Synthesis of Nucleoside Phosphorothioates(2005)13 cited
• → An efficient synthesis of nucleotides via the phosphoramidite method using a triflic acid salt of an imidazole-related compound as a promoter(2000)1 cited
• Imidazolium triflate as an efficient promoter for O-selective phosphitylation of N-unprotected nucleosides via the phosphoramidite approach.(1997)
• → ChemInform Abstract: N6‐(Carbamoylmethyl)‐2′‐deoxyadenosine, a Rare DNA Constituent: Phosphoramidite Synthesis and Properties of Palindromic Dodecanucleotides.(1987)