The nucleotide sequence of 5S rRNA from an extreme thermophile, Thermus thermophilus HB8
Nucleic Acids Research1981Vol. 9(19), pp. 5159–5162
Abstract
Using 3'- and 5'-end labelling sequencing techniques, the following primary structure for Thermusthermophilus HB8 5S RNA could be determined: pAA (U) CCCCCGUGCCCAUAGCGGCGUGGAACCACCCGUUCCCAUUCCGAACACGGAAGUGAAACGCGCCAGCGCC GAUGGUACUGGCGGACGACCGCUGGGAGAGUAGGUCGGUGCGGGGGA (OH). This sequence is most similar to Thermusaquaticus 5S RNA with which it shows 85% homology.
Related Papers
- → Comparative Analysis of 16S Ribosomal RNA Sequences of Thermus Species(1990)25 cited
- → Biochemical Properties of Unusual Polyamines Found in an Extreme Thermophile, Thermus thermophilus(1988)6 cited
- → Purification and some characteristics of a monomeric alanine racemase from an extreme thermophile, Thermus thermophilus(2000)22 cited
- → Structure of Mn-catalase from the thermophilic bacterium Thermus thermophilus.(1991)3 cited
- → The high stabilization mechanism of cold-shock protein homolog from an extreme thermophile, Thermus thermophilus HB8(2003)